Dean KaytonSimple Recursive Search and ReplaceEvery now and then I find that I need to perform a simple search and replace across many large files. Here is a simple one-liner which…Apr 4, 2019Apr 4, 2019
Dean KaytonThe correct way to run a Dockerized GUI appUsing xeyes as an example:Feb 18, 2019Feb 18, 2019
Dean KaytonBuild singularity from source (dockerized)I didn’t want to leave a bunch of build dependencies on my host system. These are the steps I took.Dec 25, 2018Dec 25, 2018
Dean KaytonUse grep to determine a count of exact sequence matches (fwd and rev barcode)grep ‘ATGATCCTATAGCAGAGGGAAGACTGCTTAGGCA’ FIZ123_pid_pool1_TY.fastq | grep -o ‘GTGTAGCTCGGTAAGAGAGACTAAGATCAG’ | wc -lNov 23, 20181Nov 23, 20181
Dean Kayton[OpenAI Retro Contest] Getting StartedWaking up inspired after attending Deep Learning Indaba𝕏WesternCape, I decided it was time to shake off the symptoms of Imposter Syndrome…Apr 7, 20182Apr 7, 20182