How to count DNA nucleotides

Drashti Shah

·

Follow

Published in

Bioinformatics with Rust

·

2 min read

·

Dec 5, 2023

--

Listen

Share

A Rust function that returns counts for A, C, G, and T in a DNA sequence

Arguments

• seq: a string slice that holds a DNA sequence

Example

let seq = "ACGT";
let counts = count_dna_nucleotides(seq);

// counts holds
// {'A': 1, 'C': 1, 'G': 1, 'T': 1}

Code

use std::collections::HashMap;

fn main() {
    let sequence: &str = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";
    let counts: HashMap<char, i32> = count_dna_nucleotides(sequence);
    println!("{:?}", counts);
}

fn count_dna_nucleotides(seq: &str) -> HashMap<char, i32> {
    let mut map = HashMap::new();
    let nucleotides = ['A', 'C', 'G', 'T'];
    for nuc in nucleotides {
        // Filter the sequence for a specific nucleotide and count the number of characters
        let count = seq.chars().filter(|&n| n == nuc).count() as i32;
        // Add the nucleotide and count pair to the hashmap
        map.insert(nuc, count);
    }
    map
}

Some notes on the code

• A HashMap in Rust is similar to a dictionary in Python
• Angle brackets or <> are used to define generic types
• The part inside the filter function |&n| n == nuc is called a closure
• A closure is like a lambda function in Python
• |&n| is a parameter (& indicates that the parameter is a reference)
• A closure can access variables from the outer scope like nuc
• filter method can be called on iterators
• &str is not an iterator but calling .chars() on &str can turn it into an iterator

Next Steps

• Play with this code in the Rust Playground
• Solve a Rosalind challenge