Cancer Biology for Patients — Episode 1

You’re here because you want to take charge of your disease. You don’t want to sit back and let it happen to you — you want to understand it and outsmart it. To hack your cancer, you have to learn its secrets and grasp how it operates. This will help you to better communicate with your team of doctors, and take a more active role in identifying and seeking out advanced treatment options.

To do this, you need to dust off your high school biology, role up your sleeves, and dive in to some science.

In this post, I will introduce you to the basic biological nature of your adversary. You should internalize this information, and if you need to, revisit it until you do. It sets the stage for everything your doctors are grappling with in your treatment. So let’s get started.

Cancer is Your Mutant Evil Twin

This first thing to understand about cancer is that it is you. What I mean by this is — it’s your own body turning against you. This is the crux of why cancer is so devilishly hard to detect and treat, but we’ll have to come back to that in detail later.

But First, Some Background

If cancer is you, then we need to talk about what you are first.

All of us complex animals are made up of cells. A cell is the smallest unit of life — we are just immense colonies of cells that take on all kinds of cooperative and specialized roles to make up a functioning organism. It’s like a big company with lots of departments full of workers with specialized jobs, working together to keep the whole thing profitable. Every cell in our body is to some degree or another really an independent living thing, though. This is why we can take cells from you and grow them in a dish, no longer connected to your body. Every individual cell in your body carries within it all of the instructions it needs to carry out its job and keep itself maintained and operating. But here’s the really wild thing — not only does every cell carry along its own instruction manual, but furthermore — every cell actually carries all of the instructions for every other cell type as well. In fact, a copy of the complete instructions to make you from scratch is carried in each and every cell in your body!

Let’s take a moment to absorb the enormity of this fact. You start out as a single cell(mom’s fertilized egg cell) which divides and divides over and over again until there are literally trillions of cells making up every part of your body. As the cells divide and your body develops, different “switches” turn on and off in the instructions inside your cells, causing them to turn into specialized versions (for skin, nerves, bone, muscle, etc.). This is a process called differentiation. But even though different parts of the instructions are turned off and on in these different kinds of cells, each still carries a full copy of the instructions.

DNA Is the Language of Life

The “instructions” I’m talking about here are written in a chemical language — your DNA. The DNA instructions inside each cell are like a library of books about every aspect of how your cells work and arrange into bodily tissues. The books are called genes and they are specific instructions for making chemical spare parts that are used to build cells, build structures around them, help them signal to each other, etc. There are roughly 20,000 of these genes in your DNA.

If we take one typical cell from your body and look at its DNA, we’d find a few characteristic things. The DNA is arranged in 46 chemical molecules called chromosomes and the chromosomes occur in pairs — so you have 23 pairs of them. Each chromosome is a long string of other, smaller chemicals — called bases — arranged like a string of beads. There are only four bases, which we label with the letters “A,” “C,” “G,” and “T” (the first letters of their scientific names). So — you can think of these letters as the simple “DNA alphabet” — everything in the DNA is “spelled” with these letters. Genes are like sentences or paragraphs, written with long strings of bases, within the larger string of a chromosome. Here’s the actual code for one of the shortest genes in humans:

GACCACGTGGCCTAATGGATAAGGCGTCTGACTTCGGATCAGAAGATTGAGGGTTCGAATCCCTTCGTGGTTA

Doesn’t look like much to you and me perhaps, but it’s really exciting info to your cells. It tells them how to make a small but very important spare part called a tRNA. Genes vary in length quite a bit, from this tiny one to genes that are thousands of letters long.

Are you with me so far? To recap:

• you’re made up of trillions of cells
• they each carry around all the instructions to make every part of you in the form of DNA code
• that code is stored in chemical strings called chromosomes
• the code is made up of four symbols that we call A, C, G, and T
• strings of these symbols make up the recipes for spare parts for cells

You may be wondering if we’re off on a tangent now — weren’t we supposed to be talking about cancer? Why the recap of AP Bio?

Well, Dear Reader — cancer is all about DNA.

Or, more specifically, DNA that gets broken in some very specific ways. So to understand cancer, you must first get a basic handle on DNA, and how things get balanced and regulated inside a healthy, working cell. Because cancer is what happens when that balance gets thrown off in just the right (or perhaps wrong?) ways…

So we’ll pause here and give you time to absorb this really important basic information. Questions so far? Hit me up in the comments below. Next time I’ll talk about some of the Rube Goldberg mechanisms inside cells that keep you alive and healthy, and how broken DNA can upset these and make your cells go rogue.

(Ready for the next bit? Click here for Episode 2)